SET WORK DRAFT 1

Role of PGC-1α in Sodium Arsenite-induced NephrotoxicityAnandi Shivaram1, Panchami P1., Kaviyarasi Renu1, Abilash V.G1*1 School of Biosciences and Technology, VIT University, Vellore, Tamil Nadu-632014, India.*Corresponding author: [email protected]:Arsenic (As) is a metalloid ubiquitous in the environment, usually found in combination with sulphur and metals. Compounds of arsenic mostly trioxides are used in the production of pesticides, insecticides and other treated wood products. Arsenic has been considered as a therapeutic as well as poisoning agent since the ancient times. Arsenic poisoning usually occurs in multicellular organisms if the quantity is larger than needed. The major concern is contamination of groundwater by Arsenic. This element in inorganic form induces oxidative stress in renal tissues which acts a precursor to nephrotoxicity. Oxidative stress influences numerous factors which eventually lead to nephrotoxicity. The kidney is one of the high- energy consuming organ, which has surplus mitochondria to meet its ATP demand. Peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) is a protein that plays a major role in mitochondrial biogenesis, energy metabolism and is enriched in tissues with high metabolic demand. In this study, we attempt to elucidate the regulation of PGC-1α by reactive oxygen species and its role in inducing nephrotoxicity.KEYWORDS: Arsenic, Nephrotoxicity, Oxidative Stress, PGC-1α.INTRODUCTION:Arsenic is a naturally occurring element ranking 20th in the Earth’s crust (1), found in combination with carbon, sulphur and other materials. It is classified as a metalloid. The main isotopes of arsenic are73As ,74As and 75As. Depending on to which element it is bound to, it can be categorized as organic or inorganic. It also occurs as Arsine gas (2).The trivalent form of Arsenic (As III, arsenite) is more toxic than pentavalent form of Arsenic (As V, arsenate) (3).Arsenic is used as a dietary supplement in trace quantities to rodent and cattle and also has therapeutic value in cancer treatment. However, consumption of Arsenic in substantial quantity leads to Arsenic poisoning. Metabolism of Arsenic is important for its toxicity as it exerts toxicity by inhibiting many enzymes involved in cellular energy pathway, DNA synthesis, repair etc. (4) Chronic ingestion of Arsenite results in its accumulation in vital organs and tissues including kidney leading to incidence of nephrotoxicity. Contaminated food and ground water act as a major source of Arsenic exposure to humans.Inorganic form of arsenic metabolizes in the cells to form toxic compounds like Dimethylarsine and trimethylarsenine, that readily react with atmospheric oxygen and form Reactive Oxygen Species (ROS) such as (OH, O2- , etc.) (5). Arsenite induces Oxidative stress by significant ROS generation mainly through Complex I and Complex II of Electron Transport Chain (ETC). Superoxide Radicals generated through the ETC reacts with various free radicals present in the cell to form stable and long- lived reactive species that damage macromolecules inducing apoptosis via various pathways (6).ROS causes calcium imbalance and decreases mitochondrial potential causing pores in the membrane. Peroxisome proliferator- activated receptor γ Coactivator – 1α (PGC-1α) is a positive regulator of mitochondrial biogenesis and respiration adaptive thermogenesis, gluconeogenesis as well as many other metabolic processes (7). Elevated levels of PGC-1α increases expression of ROS detoxifying enzymes (8,9). PGC-1α works together with transcription factors such as Peroxisome Proliferator – Activated Receptors (PPARs) Estrogen- related receptors (ERRs), retinoid X receptors (RXRs), Mitochondrial Transcription Factor A (T fam), and Nuclear Respiratory Factors (NRFs), known to regulate different aspects of energy metabolism including angiogenesis, fatty acid oxidation, antioxidant, and mitochondrial biogenesis (10) . In kidneys, PGC-1α is predominantly expressed in the proximal tubules. It activates Nuclear-encoded transcription factors such as NRF-1 and NRF-2, that promote expression of genes involved in Mitochondrial DNA Transcription and Mitochondrial Respiratory chains with Antioxidative effects (11,12). PGC-1α stimulates the expression of Mitochondrial Uncoupling Proteins UCP2 and UCP3, which dissipate the proton gradient, lower the mitochondrial potential to produce reactive oxygen radicals (13,14,15) Studies have depicted that increase in expression of PGC-1α leads suppression of acute and chronic kidney injuries and glomerular diseases. We undertake this study in order to elucidate the regulation of PGC-1α by Arsenic induced ROS eventually leading to nephrotoxicity.MATERIALS AND METHODS:Animals: Brown male rats (Rattus norvegicus) of 90 -110 g body weight housed at Animal House at VIT University, Vellore, India were selected and nursed in contained ecological conditions of 25ºC with 12 hours of light and dark cycle each for 1 month. Further, they were well fed and change in the body weight, food and water consumption was regularly noted down. The Ethical Committee at VIT University, Vellore approved the protocol and the experimental setup.Materials: Sodium arsenite-form of arsenic used to induce toxicity (acquired from Sigma Engineering and Castings, Vellore, Tamil Nadu). The chemical was diluted with drinking water before feeding in to the animal. This was stored in a cool, dark place. Experimental Design: 18 animals (body weight=230-250g) were selected, split in 3 groups viz. Control, Low dosage group (LD) and High dosage group (HD). The Control group was administered with Arsenic free HPLC water. The LD group was given a dosage of 0.01 mg/L sodium arsenite solution. The HD group were given a dosage of 10mg/L of sodium arsenite. This protocol was followed for a stretch of 56 days for all the animals present in Control, Low Dosage and High Dosage groups. After 56 days, the animals were sacrificed and a pair of kidneys were recovered. It was stored in liquid nitrogen immediately before long term storage in -80ºC.Real time PCR: RNA extraction was done using RNA Iso-plus reagent (TaKaRa Bio Inc., Japan) according to the protocol by the manufacturer. Sterile scalpel and RNAase free petri dishes were used to mince 100mg kidney specimen recovered from the male rats. Minced kidney tissues were homogenized in 1ml RNA Iso-plus using micro pestle. The homogenised sample was incubated at room temperature for 5 minutes followed by centrifugation at 12000rcf at 4ºC for 5 minutes. Proteins were denatured by adding 0.2ml chloroform and it was further incubated for 5 minutes. This was centrifuged at 12000 rcf at 4ºC for 15 minutes. RNA was precipitated using isopropanol and the pellet was obtained after centrifuging it at 12000 rcf at 4ºC for 10 minutes. Supernatant was decanted and the RNA pellet was washed with 75% ethanol. This solution was then centrifuged at 7000 rcf at 4º C for 5 minutes. The supernatant containing salts and other contaminants was discarded. The pellet was air dried and then dissolved in 40µL of DEPC treated water. RNA was quantified using Nanodrop.cDNA synthesis: The first strand of complimentary DNA was synthesised using 1000ng of total RNA. This was further reverse Transcripted using iScript a first c DNA synthesis kit from BIO-RAD by following the protocols given by the manufacturer.Real time PCR analysis: The quantification of the expression levels of target gene mRNA was done using qPCR combined with SYBR green dye (thermoscientific). The expression of genes was analysed by 2-ΔΔCt method. The control taken was β-actin. The internal control taken was β-actin. Forward primer and reverse primer 5 pM each, 1 µL of cDNA and 1x reaction mix were made use per 5 µL of reaction mix. Reaction was carried out using BioRad real- time PCR machine. The standard was taken as β-actin which was used as an internal control. The qPCR was set to follow these conditions -Initial Denaturation at 95℃ for 7 minutes, 45 Cycles of Amplification by Denaturation at 95℃ for 10 seconds, Annealing at 60℃ for 30 seconds and Elongation AT 72℃ for 30 seconds. The melting curve was analysed from 60℃ to 95℃. Different target genes have its own specific amplification value (cQ) at a particular threshold level. The PCR products detect the fluorescence.Gene Primer sequence Annealing temperatureβ-actin Forward sequences – 5’ GCAGATGTGGATCAGCAAGC 3’Reverse sequences – 5’ GCAGCTCAGTAACAGTCCGC 3’ 60℃60℃PGC-1α Forward sequences –5’GCCGGAGCAATCTGAGTTAT3’Reverse sequences – 5’GATCACCAAACAGCCGTAGA3’ 60℃60℃UCP 2 Forward sequences –5’ CCCAACCTACAGATGTGGTAAA3’Reverse sequences – 5’TCTCGTGCAATGGTCTTGTAG 3’ 60℃60℃UCP 3 Forward sequences –5’GAGGGACTATGGATGCCTAC 3’Reverse sequences –5’TGACAATGGCGTTTCTTGTG 3’ 60℃60℃Table 1: Primer Sequences for genes to be quantifiedRESULT AND DISCUSSION:RNA Isolation: Quantification of RNA: Sample (c DNA) 260nm 280nm 260/280 Concentration ngControl 0.154 0.080 1.925 2499.99Low dose 0.049 0.027 1.8148 8522.72High dose 0.074 0.045 1.6444 5434.78Table 2: Quantification of RNA using Nanodrop.Sample Volume of RNAControl 0.833Low dose 2.84High dose 1.811Table 3: Volume of RNA obtained from PCR.cDNA synthesis:Sample Volume of RNA µL 5X reaction mixture RTµL DEPC water µL Total volumeµlControl 0.833 4 1 14.167 20LD 2.84 4 1 12.16 20HD 1.811 4 1 13.189 20Table 3: Protocol for cDNA synthesis.c)Real Time-PCR:1. PGC-1α:Figure 1: Effect of sodium arsenite on PGC -1α using quantitative Real Time PCR. This indicates the number of folds of down regulation at low dosage and high dosage of sodium arsenite. ANOVA followed the Tukey-Kramer test.2.UCP-2:Figure 2: Effect of sodium arsenite on UCP 2 using quantitative Real Time PCR. This indicates the number of folds of down regulation at low dosage and high dosage of sodium arsenite. ANOVA followed the Tukey-Kramer test.3. UCP -3:Figure 3: Effect of sodium arsenite on UCP 3 using quantitative Real Time PCR. This indicates the number of folds of down regulation at low dosage and high dosage of sodium arsenite. ANOVA followed the Tukey-Kramer test.The study was performed to determine the role of sodium arsenite in regulation of PGC-1α. From the results evaluated, we observed that the expression of PGC-1α was downregulated by 0.77-folds at low dosage of sodium arsenite in kidney (Figure 1). The expression of PGC-1α was down regulated by 0.942-folds at high dosage of sodium arsenite in kidney (Figure 1).It was observed that expression of UCP2 was downregulated by 0.865-fold at low dosage of sodium arsenite and by 0.905 folds at high dosage of sodium arsenite in the kidney (Figure 2).It was also observed that expression of UCP3 was downregulated by 0.48-fold at low dosage of sodium arsenite and by 0.77 -folds at high dosage of sodium arsenite in the kidney (Figure 3). Statistical analysis was done using GraphPad Prism using one-way ANOVA followed by Tukey – Kramer test. Sodium arsenite, a trivalent form of arsenic has been used as and therapeutic agent at extremely low doses. However, accumulation of this compound in our body tissues can lead to multisystem failure. In this study we determine the effect of Arsenic in inducing nephrotoxicity by regulation a gene called PGC-1α. Arsenic induces generation of free oxygen radicals that lead to oxidative stress in the tissues of vital organs. These free radicals are mostly released from the Complexes I and II of the Electron Transport Chain. PGC-1α is an important upregulator of genes involved in Mitochondrial biogenesis. It increases expression of free radicals detoxifying enzymes thereby reducing free radical concentration. It is also enhances the expression of Mitochondrial Uncoupling Proteins- UCP-2 and UCP-3. UCP 2 and UCP-3 are proteins found in the cells. The activity of UCP2 and UCP3 on ATP generation varies with cell type (16) . PGC-1α expression also improves mitochondrial decoupling, which reduces mitochondrial membrane potential and reactive oxygen species (ROS) production, oxidative damage, mitochondrial calcium overload and potential apoptotic events through the induction of UCP2 (16) Increase in levels of PGC-1α is also robustly increases expression of UCP2 and UCP3(17). In this study it was observed that in Arsenic poisoning to renal tissues decreased expression of PGC-1α. This was equally confirmed by downregulation in expression of UCP-2 and UCP-3. This may be because of excessive production of ROS (property of As III) that downregulate expression of PGC-1α in Kidney causing Nephrotoxicity.CONCLUSION: PGC-1α, a regulatory protein along with mitochondrial uncoupling protein UCP 2 and UCP 3 showed a drastic decrease in their values which was determined in our study using qRT-PCR technique.REFERENCES:1.Woolson E.A., 1975, Bioaccumulation of arsenicals, Arsenical pesticides.2. Kaviyarasi Renu, Harishkumar Madhyastha, Radha Madhyastha, Masugi Maruyama, Sathishkumar Vinayagam, Abilash Valsala Gopalakrishnan, 2018. Review on molecular and biochemical insights of arsenic-mediated malereproductive toxicity, Toxicology letters.3. Jose L. Domingo, 1995, Prevention by chelating agents of metal-induced developmental toxicity, Reproductive Toxicology.4. Amrit Pal Singh, Rajesh Kumar Goel, Tajpreet Kaur, 2011, Mechanisms Pertaining to Arsenic Toxicity, Toxicology International. 5. Kenzo Yamaka, Hiroshi Ohba, Akira Hasegawa, Ryoji Sawamura and Shoji Okada, 1989. Mutagenecity of Dimethylated Metabolites of Inorganic Arsenics, Chemical and Pharmaceutical Bulletin. 6. Swaran J.S. Flora, 2011, Arsenic- induced oxidative stress and its reversibility, Free Radical Biology and Medicine.7. C. Handschin, Bruce M., Spiegelman, 2006, Peroxisome Proliferator- Activated Receptor γ Coactivator 1 Coactivators, Energy Homeostasis, and Metabolism, Endocrinology.8. Valle, I., Alvarez- Barrientos, A., Arza, E. Lamas, S., and Monslave, M., 2005, PGC-1α regulates the mitochondrial antioxidant defense in vascular endothelial cells. Cardiovascular Research. 9. St-Pierre J, et al, 2006, Suppression of reactive oxygen species and neurodegeneration by PGC-1 transcriptional coactivators, Cell.10. Szu-Yuan Li and Katalin Susztak, 2018, The Role of Peroxisome Proliferator-Activated Receptor γ Coactivator1α (PGC-1α) in Kidney Disease, Seminars in Nephrology.11. Weinberg, J.M., 2011, Mitochondrial biogenesis in kidney disease. Journal of American Society of Nephrology.12. Ishimoto, Y.; Inagi, R., 2016, Mitochondria: A therapeutic target in acute kidney injury. Nephrology Dialysis Transplantation.13. Puigserver, P., and Spiegelman, B.M., 2003, Peroxisome proliferator-activated coactivator 1 alpha (PGC-1 alpha): transcriptional coactivator and metabolic regulator., Endocrine Reviews.14. St-Pierre, J., Lin, J., Krauss, S., Tarr, P.T., Yang, R., Newgard, C.B., andactivated receptor gamma coactivators 1alpha and 1beta (PGC-1alpha andPGC-1beta) in muscle cells. Journal of Biological Chemistry.15. Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R.C., and Spiegelman, B.M. ,1999, Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1, Cell.16. Andrews ZB, Diano S, Horvath TL, 2005, Mitochondrial uncoupling proteins in the CNS: in support of function and survival, Nature Reviews. Neuroscience.17. Puigserver, P., Rhee, J., Lin, J., Wu, Z., Yoon, J. C., Zhang, C. Y., Krauss, S., Mootha, V. K., Lowell, B. B. and Spiegelman, B. M. , 2001, Cytokine stimulation of energy expenditure through p 38 MAP kinase activation of PPAR-γ coactivator-1. Molecular Cell.